Cap | Flexfit Snapback

32,90 

  • 6 Panel Cap Flexfit Cap
  • ANYML Webpatch auf der Vorderseite
  • Perfekte Passform durch Elasthaneinsatz und Flexfit®-Band
  • Rückseite voll geschlossen
  • 6 gestickte Luftlöcher
  • 8 Ziernähte am Schild
  • 98% Baumwolle / 2% Elasthan

Artikelnummer: n. v. Kategorie:

Beschreibung

Schwarze 6 Panel Cap mit gewebtem ANYML Patch auf der Vorderseite. Ohne Verschluss mit flachem Schirm, perfekte Passform durch Elasthaneinsatz und Flexfit©-Band. Die Cap kommt in den Größen S/M für einen Kopfumfang von ca. 56/57 cm und L/XL für einen Kopfumfang von ca. 58/59 cm.

Zusätzliche Informationen

Größe

S/M, L/XL

Bewertungen

  1. Dhamaj

    buy generic lasuna – himcolin buy online buy himcolin paypal

    Nicht verifizierter Kauf. Mehr Informationen

  2. Symnpaymn

    Taken in conjunction with the total T4, however, the T3RU offers insight into the cause of any given deviation of T4 concentration buy priligy on the internet without a prescription Is combination therapy with bevacizumab recommended as first or second line treatment for HER2 negative metastatic breast cancer

    Nicht verifizierter Kauf. Mehr Informationen

  3. can you get cytotec

    where can i get cheap cytotec for sale Primer probe sets for RPL19 are F, 5 ATGTATCACAGCCTGTACCTG 3; R, 5 TTCTTGGTCTCTTCCTCCTTG 3; and P, 5 FAM AGGTCTAAGACCAAGGAAGCACGCAA TAMRA p 3

    Nicht verifizierter Kauf. Mehr Informationen

Füge deine Bewertung hinzu

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert